View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3761_low_32 (Length: 312)
Name: NF3761_low_32
Description: NF3761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3761_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 51616115 - 51616418
Alignment:
| Q |
1 |
attgtacttatatcttggtcttggctgcattgtttgagattaagagaaattggggtccatttaaactggcaaatgcatgttttgattttgacacagctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51616115 |
attgtacttatatcttggtcttggctgcattgtttgagattaagagaaattggggtccatttaaactggcaaatgcatgttttgattttgacacagctgc |
51616214 |
T |
 |
| Q |
101 |
tgttggtgaagggtgactggtgagtcatgatctgtttctttctccattttcaactttcatgctccttgttgggttattattagatgttgttttggagttg |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
51616215 |
tgttggtgaatggtgactggtgagtcatgatctgtttctttctccattttcaactttcatgctccttgttgggttattattagatgttgctttggaggtg |
51616314 |
T |
 |
| Q |
201 |
attggtgtgtcaaagataaatgttcaagttatgacctttgtttttagaattttatttgtcttcaattcttggtcatttcatagattgatcagcgtgagaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51616315 |
attggtgtgtcaaagataaatgttcaagttatgacctttgtttttagaattttatttatcttcaattcttggtcatttcatagattgatcagcgtgagaa |
51616414 |
T |
 |
| Q |
301 |
taat |
304 |
Q |
| |
|
|||| |
|
|
| T |
51616415 |
taat |
51616418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University