View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3761_low_34 (Length: 301)
Name: NF3761_low_34
Description: NF3761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3761_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 83 - 285
Target Start/End: Original strand, 735616 - 735818
Alignment:
| Q |
83 |
agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735616 |
agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg |
735715 |
T |
 |
| Q |
183 |
ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaaagttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735716 |
ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaacgttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa |
735815 |
T |
 |
| Q |
283 |
act |
285 |
Q |
| |
|
||| |
|
|
| T |
735816 |
act |
735818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 735543 - 735600
Alignment:
| Q |
1 |
agagaagctagtttccgtcataggtcactggctaccgttcccgttccgacgagagcag |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735543 |
agagaagctagtttccgtcataggtcactggctaccgttcccgttccgacgagagcag |
735600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University