View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3761_low_38 (Length: 263)
Name: NF3761_low_38
Description: NF3761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3761_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 256
Target Start/End: Original strand, 34386147 - 34386400
Alignment:
| Q |
15 |
acaaagtttaaagaagcaacacaaaaatgaagttgggaatgttaaaggatagttgaatttgttaggtaagttgatgtatgatgaattgtataatttgagc |
114 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34386147 |
acaaagtttagagaagtaacacaaaaatgaagttgagaatgttaaaggatagttgaatttgttaggtaagttgatgtatgatgaattgtataatttgagc |
34386246 |
T |
|
| Q |
115 |
tggggtggaagaaggtttcttaatttatagggaggtgacaatatctttactcttcatagatattaccaacgnnnnnnnnnnnnatttgttaagaattttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
34386247 |
tggggtggaagaaggtttcttaatttatagggaggtgacaatat-tttactcttcatagatactaccaacgtttttcttttttatttgttaagaattttg |
34386345 |
T |
|
| Q |
215 |
tgttg-------------ttggagcatgcaagtggtggaccaacaactgatgatg |
256 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34386346 |
tgttgactcaaaattttgttggagcatgcaagtggtggaccaacaactggtgatg |
34386400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University