View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3761_low_39 (Length: 258)
Name: NF3761_low_39
Description: NF3761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3761_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 50706542 - 50706308
Alignment:
| Q |
9 |
agcaaaggaaaattgttaaaattaaagcactgtgcatcgaatgtatacagtgttcatctttgtttttaaagttgatggtgtttgtattttcaaaaatcaa |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50706542 |
agcaaaagaaaattgttaaaattaaagcactgtgcatcgaatgtatacagtgttcatctttgtttttaaagttgatggtgtttgtattttcaaaaatcaa |
50706443 |
T |
 |
| Q |
109 |
ttgctgcattattcaactgggccaaaaggaaaaaacctgcaattatttctcaaatttggannnnnnnct-ttcccaaaacgtgtttgtaatctatgttga |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||| ||| |
|
|
| T |
50706442 |
ttgctgcattattcaactggaccaaaaggaaaaaacctgcaattatttctcaaatttggatttttttttcttcccaaaacgtgttggtaatctatgctga |
50706343 |
T |
 |
| Q |
208 |
attactttttcttttctctactattgttaaagatg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
50706342 |
attactttttcttttctctactattgttaaagatg |
50706308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University