View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3762_high_33 (Length: 302)
Name: NF3762_high_33
Description: NF3762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3762_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 14 - 267
Target Start/End: Complemental strand, 42916919 - 42916665
Alignment:
| Q |
14 |
caaaggaaggacagctagctacaaaacgacaacatagtcggtgatgtggtttccacgtgtcatacatccattgg-atataggtacggtttacgttgttaa |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42916919 |
caaagaaaggacagctagctacaaaacgacaacatagtcggtgatgtggtttccacgtgtcatacatccattgggatataggtacggtttacgttgttaa |
42916820 |
T |
 |
| Q |
113 |
atccatgtagggttgggcccatcatagttggtccattggcccaccagccgaccatagccaatacagtttagaattagatggacgatcgtatgccacctag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42916819 |
atccatgtagggttgggcccatcatagttggtccattggcccaccagccgaccatagccaatacagtttagaattagatggacgatcatatgccacctag |
42916720 |
T |
 |
| Q |
213 |
tatatgatttgacaccaacggtgaaaaataaacctacaattaattagtaaatatg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42916719 |
tatatgatttgacaccaacggtgaaaaataaacctacaattaattagtaaatatg |
42916665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University