View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3762_high_46 (Length: 242)
Name: NF3762_high_46
Description: NF3762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3762_high_46 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 6157164 - 6156937
Alignment:
| Q |
18 |
ctttttggtaatcttttgctt-gtttatttatttctctcatgccaccacttaatagtttagttatgat--gcagctgaaggtttttcatctttgttttat |
114 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6157164 |
ctttttggtaatcttttgctttgtttatttattactctcatgccaccacttaatagtatagttatgatatgcagctgaaggtttttcatctttgttttat |
6157065 |
T |
 |
| Q |
115 |
gataacaaatttatctagtgtttaaacacctatgttcatttatcttagtctcgtannnnnnnnaactctacctatacatcatatgttttatgttgataca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
6157064 |
gataacaaatttatctagtgtttaaacacctatgttcatttatcttagtctcgtattttttttaactctacctatacatcacatgttttctgttgataca |
6156965 |
T |
 |
| Q |
215 |
ttgttcttctcctactaatttacatgca |
242 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
6156964 |
ttgttcttctcccactaatttacatgca |
6156937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 132
Target Start/End: Complemental strand, 54033190 - 54033134
Alignment:
| Q |
75 |
tagttatgatgcagctgaaggtttttcatctttgttttatgataacaaatttatctag |
132 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||| ||||||| || |||||||||||| |
|
|
| T |
54033190 |
tagttatgatacagctgaaggcttttcatctttg-tttatgacaataaatttatctag |
54033134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University