View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3762_low_38 (Length: 332)
Name: NF3762_low_38
Description: NF3762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3762_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 18 - 327
Target Start/End: Original strand, 28239566 - 28239875
Alignment:
| Q |
18 |
atatatttgagcaaaatctaactggctttcttaatcatatgttttggtaaatatagatcaatgttgaagctcttttcaaatggaaatacaggttctcagt |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28239566 |
atatatttgagcaaaatctatctggctttcttaatcatatgttttggtaaatatatatcaatattgaagctcttttgaaatggaaatacaggttctcagt |
28239665 |
T |
|
| Q |
118 |
gttgagaataatgcattgagtatcaacttcccattgatgtgctctcaatctggcttttcttctttcnnnnnnnnagaaaaatgatcaggtgaatagtgac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28239666 |
gttgagaataatgcattgagtatcaacttcccattgatgtgctctcaatctggcttttcttctttcttttttttagaaaaatgatcaggtgaatagtgac |
28239765 |
T |
|
| Q |
218 |
aggctcagagaaagtctcgagaaaatagtcggtacagatgattcgaggtttagtggatttgaccttgctactcttatcaggaacaaatatgggaaatctg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28239766 |
aggctcagagaaagtctcgagaaaatagtcggtacagatgattcgagatttagtggatttgaccttgctactcttatcaggaacaaatatgggaaatctt |
28239865 |
T |
|
| Q |
318 |
atgatgtcca |
327 |
Q |
| |
|
|||||||||| |
|
|
| T |
28239866 |
atgatgtcca |
28239875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University