View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3762_low_42 (Length: 292)
Name: NF3762_low_42
Description: NF3762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3762_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 14 - 276
Target Start/End: Original strand, 40295807 - 40296080
Alignment:
| Q |
14 |
gaagagcagtgagaaattggagaatgtggactgggaggatgttatcactctcttggatgataacgaatggccagaaaatacaccaagtttcaggtacaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40295807 |
gaagagcagtgagaaattggagaatgtggactgggaggatgttatcactctcttggatgataacgaatggccagaaaatacaccaagtttcaggtacaaa |
40295906 |
T |
|
| Q |
114 |
gcaaatcaaatgttctttccaagtaaaagttagtcaagcatattgatatcagaaagaacaccacctgtcatctcatgcatactctcttctgttatacatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40295907 |
gcaaatcaaatgttctttccaagtaaaagttagtcaagcatattgatatcagaaagaacaccacctgtcatctcatgcatactctcttctgttatacatt |
40296006 |
T |
|
| Q |
214 |
ata-----------cttactcaccaggaagaatttatttcttgtataaaaatataataacataactaatatact |
276 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40296007 |
atacttactctggtcttactcaccaggaagaatttatttcttgtataaaaatataataacataactaatatact |
40296080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University