View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3762_low_44 (Length: 262)
Name: NF3762_low_44
Description: NF3762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3762_low_44 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 14 - 262
Target Start/End: Complemental strand, 35808766 - 35808518
Alignment:
| Q |
14 |
caaagggaagaaactgtgaattctttggcttatgaagctgatgcaaggcttagagaccctgtctatggatgcataggtgctatagcacttttgcaaagga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808766 |
caaagggaagaaactgtgaattctttggcttatgaagctgatgcaaggcttagagaccctgtctatggatgcataggtgctatagcacttttgcaaagga |
35808667 |
T |
|
| Q |
114 |
agatggttgaacttcaacatgatcttgccattgcaaaggatcgtctggctcgttgcgctgcggctgctgctactcctacttcttctttttccaatgatat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808666 |
agatggttgaacttcaacatgatcttgccattgcaaaggatcgcctggctcgttgcgctgcggctgctgctactcctacttcttctttttccaatgatat |
35808567 |
T |
|
| Q |
214 |
gatgaattcaaatgttagtttgccaccttttcctgagtttttcacttgc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808566 |
gatgaattcaaatgttagtttgccaccttttcctgagtttttcacttgc |
35808518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 14 - 168
Target Start/End: Complemental strand, 32036399 - 32036245
Alignment:
| Q |
14 |
caaagggaagaaactgtgaattctttggcttatgaagctgatgcaaggcttagagaccctgtctatggatgcataggtgctatagcacttttgcaaagga |
113 |
Q |
| |
|
||||| ||||| || ||||||||| | |||||||||||||| ||||||||||||||||| || || |||||||| ||| | ||||| | |||||||||| |
|
|
| T |
32036399 |
caaagagaagacacagtgaattctcttgcttatgaagctgaagcaaggcttagagacccagtttacggatgcattggttccatagctatgttgcaaagga |
32036300 |
T |
|
| Q |
114 |
agatggttgaacttcaacatgatcttgccattgcaaaggatcgtctggctcgttg |
168 |
Q |
| |
|
||||| | |||||||| |||||| | |||||||| ||||| ||||| |||||||| |
|
|
| T |
32036299 |
agatgatggaacttcagcatgatttggccattgctaaggaacgtcttgctcgttg |
32036245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University