View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3762_low_56 (Length: 238)
Name: NF3762_low_56
Description: NF3762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3762_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 12 - 178
Target Start/End: Original strand, 5762722 - 5762888
Alignment:
| Q |
12 |
attatggtcaagaggtatgaagataaaaacaatctacatttgttttgttcccaaaaaataaaattctgcatttttaggatggacttcccaaaacaaactc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5762722 |
attatggtcaagaggtatgaagataaaaacaatctacatttgttttgttcccaaaaaataaaattctacatttttaggatggacttcccaaaacaaactc |
5762821 |
T |
 |
| Q |
112 |
ttctagattgaatatgtttggaaaagttataatgttatagattttatagtcttttacttattatgca |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5762822 |
ttctagattgaatatgtttggaaaagttataatgttatagattttatagtcttttacttattatgca |
5762888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University