View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3762_low_58 (Length: 230)
Name: NF3762_low_58
Description: NF3762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3762_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 13114214 - 13114427
Alignment:
| Q |
1 |
tgaataagaacaaaaagtgcaagattgttgttgccatgatcactttttgtgcctctactcgctggaattactaaccaaacaacaatctgcaattcgaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13114214 |
tgaataagaacaaaaagtgcaagattgttgttggcatgatcactttttgtgcctctactcgctggaattactaaccaaacaacaatctgcaattcgaaca |
13114313 |
T |
|
| Q |
101 |
aactcatcaatcaatatc-tttttaaacaggctatcctcaaaagggagtctttcccaaaattcttaaaggtctaagcgaaacttagacctaagcggaggt |
199 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
13114314 |
aactcatcaatcaatatcttttttaaacaggctatcctcaaaagggagtctttccaaaaattctcaagggtctaaccgaaacttagacctaagcggaggt |
13114413 |
T |
|
| Q |
200 |
ttagaaatagtttt |
213 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
13114414 |
ttcgaaatagtttt |
13114427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University