View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3762_low_59 (Length: 228)
Name: NF3762_low_59
Description: NF3762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3762_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 213
Target Start/End: Original strand, 29789016 - 29789209
Alignment:
| Q |
20 |
gaagtaatacaggaaagaaaacaaggaaaatgattaggtaaatcatacttacccaaatgtccccataactcgagtcgtgacataactattctcggaattt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29789016 |
gaagtaatacaggaaagaaaacaaggaaaatgattaggtaaatcatacttacccaaatgtccccataactcgagtcgtgacataactattctcggaattt |
29789115 |
T |
 |
| Q |
120 |
aaaagcttggcaagcccgaaatcagacaccttggagttccattggcgatcaaggaggatgttgcttgatttcacatctcggtgaacaacctttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29789116 |
aaaagcttggcaagcccgaaatcagacaccttggagttccattggcgatcaaggaggatgttacttgatttcacatctcggtgaacaacctttg |
29789209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 59 - 202
Target Start/End: Complemental strand, 11037479 - 11037336
Alignment:
| Q |
59 |
aaatcatacttacccaaatgtccccataactcgagtcgtgacataactattctcggaatttaaaagcttggcaagcccgaaatcagacaccttggagttc |
158 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||| || | || |||| | |||||| ||||| ||||||||||| ||||| |||||| |
|
|
| T |
11037479 |
aaatcatactaacccaaatgtccccatcactcgagtcgtgacatagctgtggtcagaatgcagaagcttagcaagaccgaaatcagaaaccttagagttc |
11037380 |
T |
 |
| Q |
159 |
cattggcgatcaaggaggatgttgcttgatttcacatctcggtg |
202 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
11037379 |
cattgacgatcaatgagtatgttgcttgatttcacatctcggtg |
11037336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 4979297 - 4979257
Alignment:
| Q |
167 |
atcaaggaggatgttgcttgatttcacatctcggtgaacaa |
207 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||| ||||||| |
|
|
| T |
4979297 |
atcaagaaggatgttgtttgatttcacatctcgatgaacaa |
4979257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University