View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3763_low_10 (Length: 247)
Name: NF3763_low_10
Description: NF3763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3763_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 4132523 - 4132296
Alignment:
| Q |
1 |
ttcatatgatggcagaatttgatcagtgggggtccgaggtggttttttgacaagaaatattttagctagtcaaactcatagcttatatatctgttatctc |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
4132523 |
ttcatatcatggcagaatttgatcagtgggggtccgaggtggttttttgacaagaaatattttagctagtcaaactcatagcttattt----gttatctc |
4132428 |
T |
|
| Q |
101 |
ataccaatatggctctactcatgcacaatattgcaactacctttaaattggtcttttactatctatggtgtcttgctgtgtatgaattatgacaaggcag |
200 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4132427 |
ataccaacatggctctactcatgcataatattgcaactacctttaaattggtcttttactatctatggtgtcttgctgtgtatgaattatgacaaggcag |
4132328 |
T |
|
| Q |
201 |
ttggaaccttatctaaatttattagtaatata |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4132327 |
ttggaaccttatctaaatttattagtaatata |
4132296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 102 - 183
Target Start/End: Original strand, 41103491 - 41103572
Alignment:
| Q |
102 |
taccaatatggctctactcatgcacaatattgcaactacctttaaattggtcttttactatctatggtgtcttgctgtgtat |
183 |
Q |
| |
|
|||||||||| |||||||||||| ||| ||| ||||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
41103491 |
taccaatatgattctactcatgcataatgttgaaactacctttaaattggcctttcgttatctatggtggcttgctgtgtat |
41103572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 41081106 - 41081174
Alignment:
| Q |
102 |
taccaatatggctctactcatgcacaatattgcaactacctttaaattggtcttttactatctatggtg |
170 |
Q |
| |
|
||||||||||| ||||||||||| ||| || ||||| ||||| |||||||||| | ||||||||||| |
|
|
| T |
41081106 |
taccaatatggttctactcatgcctaatgttaaaactaactttagattggtctttcattatctatggtg |
41081174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 141 - 183
Target Start/End: Original strand, 35648837 - 35648879
Alignment:
| Q |
141 |
ctttaaattggtcttttactatctatggtgtcttgctgtgtat |
183 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
35648837 |
ctttaaattggtcttctactatctatggtgtcttgctgcgtat |
35648879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University