View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3763_low_9 (Length: 261)
Name: NF3763_low_9
Description: NF3763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3763_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 3 - 246
Target Start/End: Original strand, 30286099 - 30286343
Alignment:
| Q |
3 |
agcagcagcaatgatgaacac-ttcaaccaggtccctttgatagtgaaaggttgccacctgtttttgattctgaaattcaaagattccttcgtgttgcta |
101 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30286099 |
agcagcagcaatgatgaacaccttcaaccaggtccctttgatagtgaaaggttgccacctgtttttgattctgaaattcaaagattccttcgtgttgcta |
30286198 |
T |
|
| Q |
102 |
atttgctcgaaagggaggagcctcgtgttgcttacctttgtaagtctttgaaacatcttcaaatgtgtttctcgttagttaatatggtatctaattcgtt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30286199 |
atttgctcgaaagggaggagcctcgtgttgcttacctttgtaagtctttgaaacatcttcaaatgtgtttctcgttagttaatatggtatctaattcgtt |
30286298 |
T |
|
| Q |
202 |
ttcgttagctaccttggtcattgaaactgtcttctatctattagt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30286299 |
ttcgttagctaccttggtcattgaaactgtcttctatctattagt |
30286343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University