View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3764_high_15 (Length: 320)
Name: NF3764_high_15
Description: NF3764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3764_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 24511373 - 24511567
Alignment:
| Q |
1 |
gccattgttctctttttctgccccgtatgtttctgctaatgttactacaattttgnnnnnnnn-agtctggtccaaatttcatgttagttgagactat-- |
97 |
Q |
| |
|
||||||| |||| |||||||| |||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24511373 |
gccattgctctccttttctgctccgtatgtgtctgctggtgttactacaattttatttttttttagtctggtccaaatttcatgttagttgagactatat |
24511472 |
T |
|
| Q |
98 |
ttttggattgtaatttggttcgtaattgaaatgcacatccatgacttggttgtcatttgcagtcgttatggggattcatttctagctttgtgaaa |
192 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24511473 |
ttttggattgtaattttgttcgtaattgaaatgcacatccatgacttggttgtcatttgcagtcgttatggggattcatttctagctttgtgaaa |
24511567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 243 - 312
Target Start/End: Original strand, 24511616 - 24511685
Alignment:
| Q |
243 |
gacaattattatcatgtggtcctggtgttctgttttgataggaaaagtacattttgtgcacaggttctgc |
312 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24511616 |
gacaattattatcatgtggtcctcgtgttctgttttgataggaaaagtacattttgtgcaatggttctgc |
24511685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University