View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3764_high_25 (Length: 227)
Name: NF3764_high_25
Description: NF3764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3764_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 36534357 - 36534551
Alignment:
| Q |
15 |
agcacagatatattatgcgaattcgtttgtttgcactttgcagccattgttgagagctacttcttcctttccattgcgtcccctctccactatgtgattg |
114 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534357 |
agcacacatatattacgcgaattcgtttgtttgcactttgcagccattgttgagagctacttcttcctttccattgcgtcccctctccactatgtgattg |
36534456 |
T |
 |
| Q |
115 |
catataattctccccagcactgctatatggcacgacatgccattcgttgaatctgcacgagcgcttaattttagtcacttgcttggcttataaat |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534457 |
catataattctcaccagcactgctatatggcacgacatgccattcgttgaatctgcacgagcgcttaattttagtcacttgcttggcttataaat |
36534551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University