View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3764_low_27 (Length: 242)
Name: NF3764_low_27
Description: NF3764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3764_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 239
Target Start/End: Original strand, 4769760 - 4769979
Alignment:
| Q |
20 |
actcgtcacgctatcctcacgctgatttaccttctcattcacatcataattcttcttcccggtgaaaatcaaattgtataacgcaaatagactcaaaaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4769760 |
actcgtcacgctatcctcacgctgatttaccttctcattcacatcataattcttcttcccggcgaaaatcaaattgtataacgcaaatagactcaaaaca |
4769859 |
T |
|
| Q |
120 |
gagcttaaaatccaaccgatattgtatagatccatatcggaggaatctcgccggcgatggtgacagtggtgatgacggagaattaggtgtagttatttgc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4769860 |
gagcttaaaatccaaccgatattgtatagatccatatcggaggaatctcgccggcgatggtgacagtggtgatgacggagaattaggtgtagttattggc |
4769959 |
T |
|
| Q |
220 |
gtttgagattcttctctctc |
239 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4769960 |
gtttgagattcttctctctc |
4769979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University