View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3765_high_23 (Length: 313)
Name: NF3765_high_23
Description: NF3765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3765_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 10367008 - 10366712
Alignment:
| Q |
1 |
cagaggatttgaaattatataaaatatttctcatagcaatgctatcatgtagaattaacttattatttgttgaatagatttataacaaaactttggcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
10367008 |
cagaggatttgaaattatataaaatatttctcatagcaatgctatcatgtagaattaacttattattagttaaatagatttataacaaaactttggcatt |
10366909 |
T |
 |
| Q |
101 |
gtctatgtaaataaagctctagtctagctttacactagtttgtcgatctagctttataatagtgactgcgtctattgttgtttcagnnnnnnngccatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10366908 |
gtctatgtaaataaagctctagtctagctttacactagtttgtcgatctagctttataatagtgactgcgtctattgttgtttcagtttttttgccatct |
10366809 |
T |
 |
| Q |
201 |
tcgcatatcacaattaacgtttggtggctcgaattccccttccttgtcatgaccactgaggaaagtgtgttggcagcatgataacaataacactttg |
297 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
10366808 |
tcgcatatcacaatgaacgtttggtggctcgaattccccttccttgtcatgaccactgaggaaagtgtgttggcagcatggtgacaataacactttg |
10366712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University