View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3765_high_25 (Length: 292)
Name: NF3765_high_25
Description: NF3765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3765_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 34 - 275
Target Start/End: Complemental strand, 40373797 - 40373556
Alignment:
| Q |
34 |
acttaaattgaaatttgtgtttatttaaatctcaaaaccataaaattatcttttataattctgagtttttattacgacaaccactgactacttcttctac |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40373797 |
acttaaattgaaatttgtgtttatttaaatctcaaaaccataaaattatcttttataattctgagtttttattacgacaaccactgactacttcttctac |
40373698 |
T |
 |
| Q |
134 |
tattattaatcactactttgaccaccactcatgccgcctttggtcactattctcattacctctgaccaccactctgatgctacctcgaccgttatagcca |
233 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40373697 |
tattattaatcattacttcgaccaccactcatgccgcctttgatcaatattctcattacctctgaccaccactctgatgctacctcgaccgttatggcca |
40373598 |
T |
 |
| Q |
234 |
cttcgaccaatcaaccaccactaacaactacttcagcccttc |
275 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40373597 |
cgtcgaccgatcaaccaccactaacaactacttcagcccttc |
40373556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University