View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3765_high_35 (Length: 230)

Name: NF3765_high_35
Description: NF3765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3765_high_35
NF3765_high_35
[»] chr3 (5 HSPs)
chr3 (22-138)||(4230405-4230520)
chr3 (22-138)||(4239920-4240035)
chr3 (19-135)||(4223444-4223557)
chr3 (23-111)||(4248826-4248914)
chr3 (185-216)||(4223363-4223394)
[»] chr5 (1 HSPs)
chr5 (20-64)||(20890222-20890266)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 4e-37; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 22 - 138
Target Start/End: Complemental strand, 4230520 - 4230405
Alignment:
22 gtttttgtatgctatgactttatttcttttcctatttcatattgaaaagagcagtggtggtaatatgnnnnnnncatccttttcaaatttatgtctttag 121  Q
    ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||    
4230520 gtttttgtatgctatgactttatttcttttcttacttcatattgaaaagagcagtggtggtaatatg-atttctcatccttttcaaatttatgtctttag 4230422  T
122 tatgtagttgtacattg 138  Q
    | |||||||||||||||    
4230421 tttgtagttgtacattg 4230405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 22 - 138
Target Start/End: Complemental strand, 4240035 - 4239920
Alignment:
22 gtttttgtatgctatgactttatttcttttcctatttcatattgaaaagagcagtggtggtaatatgnnnnnnncatccttttcaaatttatgtctttag 121  Q
    ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||    
4240035 gtttttgtatgctatgactttatttcttttcttacttcatattgaaaagagcagtggtggtaatatg-atttctcatccttttcaaatttatgtctttag 4239937  T
122 tatgtagttgtacattg 138  Q
    | |||||||||||||||    
4239936 tttgtagttgtacattg 4239920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 4223557 - 4223444
Alignment:
19 aaagtttttgtatgctatgactttatttcttttcctatttcatattgaaaagagcagtggtggtaatatgnnnnnnncatccttttcaaatttatgtctt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||       |||||||||||||||||||||||    
4223557 aaagtttttgtatgctatgactttatttcttttcctatttcatattgaaaagagcagtggt---aatatgtttttttcatccttttcaaatttatgtctt 4223461  T
119 tagtatgtagttgtaca 135  Q
    |||| |||| |||||||    
4223460 tagtttgtaattgtaca 4223444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 23 - 111
Target Start/End: Complemental strand, 4248914 - 4248826
Alignment:
23 tttttgtatgctatgactttatttcttttcctatttcatattgaaaagagcagtggtggtaatatgnnnnnnncatccttttcaaattt 111  Q
    |||||||||||||| |||||||||||||||||||||| ||| ||||||| || |||||||||||||       ||||||||||||||||    
4248914 tttttgtatgctatcactttatttcttttcctatttcttatcgaaaagaacaatggtggtaatatgttattctcatccttttcaaattt 4248826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 216
Target Start/End: Complemental strand, 4223394 - 4223363
Alignment:
185 cagctttaattgattgtaaaacagttgatgat 216  Q
    ||||||||||||||||||||||||||||||||    
4223394 cagctttaattgattgtaaaacagttgatgat 4223363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 20890266 - 20890222
Alignment:
20 aagtttttgtatgctatgactttatttcttttcctatttcatatt 64  Q
    |||||| |||||| ||||| |||||||||||||||||||| ||||    
20890266 aagtttgtgtatgttatgattttatttcttttcctatttcttatt 20890222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University