View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3765_low_17 (Length: 378)
Name: NF3765_low_17
Description: NF3765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3765_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 49 - 202
Target Start/End: Original strand, 35393845 - 35393998
Alignment:
| Q |
49 |
agtttgtgtttgaaattggaaacttcattacactttcacacattttgttggttaccgtaacccaacccccagcacatttatttacgatatcatcatcata |
148 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35393845 |
agtttgtgtttgaaattggaaacttcattgcactttcacacattttgttggttaccgtaacccaacccccagcacatttatttacgatatcatcatcata |
35393944 |
T |
 |
| Q |
149 |
ataataacatttaacacaacacaacaacaacctcattgtaatttctgaaactca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35393945 |
ataataacatttaacacaacacaacaacaacctcattgtaatttctgaaactca |
35393998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 224 - 364
Target Start/End: Original strand, 35394029 - 35394169
Alignment:
| Q |
224 |
attgtggatctcgaataagatggggattgcagaagagagagttgtggcggttatcatggttggaggacccaccaaaggcactcgattccgtccattatca |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35394029 |
attgtggatctcgaataagatggggattgcagaagagagagttgtggcggttatcatggttggaggacccaccaaaggcactcgattccgtccattatca |
35394128 |
T |
 |
| Q |
324 |
ttcaacattcctaaaccactctttccattagctggacaacc |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35394129 |
ttcaacattcctaaaccactctttccattagctggacaacc |
35394169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University