View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3765_low_37 (Length: 231)
Name: NF3765_low_37
Description: NF3765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3765_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 15 - 194
Target Start/End: Original strand, 38365466 - 38365636
Alignment:
| Q |
15 |
agagagcaaggaaaaaatagttagaccctcctagaattgtggagtagaaaatgtcaacggaaaatgtcaacgttttatcat----ctgtttggaaccgaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
38365466 |
agagagcaaggaaaaaatagttagaccctcctagaattgtggagtagaaaatgtcaatg-------------ttttatcatacatctgtttggaaccgaa |
38365552 |
T |
 |
| Q |
111 |
atggatcctctcatatgtgatttaaacatgagaggtaatactaatgtgtgtaattacttaccattcaaaatgaacgagacacgt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38365553 |
atggatcctctcatatgtgatttaaacatgagaggtaatactaatgtgtgtaattacttaccattcaaaatgaacgagacacgt |
38365636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University