View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3766_high_9 (Length: 261)
Name: NF3766_high_9
Description: NF3766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3766_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 21 - 246
Target Start/End: Complemental strand, 45204052 - 45203828
Alignment:
| Q |
21 |
gtataattttttatttattttggaaagataattgaaaccaccaaaccaatgcatcgatcctttataatggttcggttcataatgaacaattaacggttca |
120 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45204052 |
gtataatttttttttttttttggaaagataattgaaaccaccaaaccaatgcatcgatcctttgtaatggttcggttcagaatgaacaattaacggttca |
45203953 |
T |
 |
| Q |
121 |
attcaattttaacaaacttttataccgattcagtttggttttcttccccgaacccgaatcgtgaacaatactacatatctaggtttgtttatcttttttg |
220 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45203952 |
attcaattttaacaaacttttgtaccaattcagtttggttttcttccccgaa-tcaaatcgtgaacaatactacatatctaggtttgtttgtcttttttg |
45203854 |
T |
 |
| Q |
221 |
ttggtacaaaatctaggtttggtttt |
246 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45203853 |
ttggtacaaaatctaggtttggtttt |
45203828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University