View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3766_low_8 (Length: 293)
Name: NF3766_low_8
Description: NF3766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3766_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 16 - 275
Target Start/End: Complemental strand, 43616877 - 43616618
Alignment:
| Q |
16 |
atcaaagtactctcaaactagtgggagataaaaaatgtggcttcgtcaagtcatgtttcaaactatacaaaattattattatacactgtttttataatgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43616877 |
atcaaagtactctcaaactagtgggagataaaaaatgtggcttcgtcaagtcatgtttcaaactatacaaaattattattatacactgtttttataatgt |
43616778 |
T |
 |
| Q |
116 |
caacaaccatgacctactggggactcttagtcaataaatggatgacaataatcattatatgtatcacttattggcgcaacaaattaatgctataccctgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43616777 |
caacaaccatgacctactggggactcttagtcaataaatggatgacaataatcattatatgtatcacttattggcgcaacaaattaatgctataccctgc |
43616678 |
T |
 |
| Q |
216 |
tggtggaatctactatgtcataggatagggtcatcaaacattgctaaaataagtatatgc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43616677 |
tggtggaatctactatgtcataggatagggtcatcaaacattgctaaaataagtatatgc |
43616618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University