View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3767_high_21 (Length: 273)
Name: NF3767_high_21
Description: NF3767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3767_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 4 - 257
Target Start/End: Original strand, 49468231 - 49468484
Alignment:
| Q |
4 |
tgatttactgaacaaaattattgaccatgtgctaatatttgtcactgggataaaatcttcagcatattgcaccagaattagttttgcttatgcattgtta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49468231 |
tgatttactgaacaaaattattgaccatgtgctaatatttgtcactgggataaaatcttcagcatattgcaccagaattagttttgcttatgcattgtta |
49468330 |
T |
 |
| Q |
104 |
tccatttggaacttttctttcacagaacacaagaactagtaactttgtctggagcccacactcttggaagtaaaggttttggaagccctacttcttttga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49468331 |
tccatttggaacttttctttcacagaacacaagaactagtagctttgtctggagcccacactcttggaagtaaaggttttggaagccctacttcttttga |
49468430 |
T |
 |
| Q |
204 |
caattcatattataaggttcttttggagaagccatggacgccttctggtaaaat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49468431 |
caattcatattataaggttcttttggagaagccatggacgccttctggtaaaat |
49468484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University