View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3767_high_28 (Length: 241)

Name: NF3767_high_28
Description: NF3767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3767_high_28
NF3767_high_28
[»] chr8 (1 HSPs)
chr8 (1-155)||(32834245-32834399)


Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 32834399 - 32834245
Alignment:
1 cggaggtaaccaagttttgattatagatgaagacctccgtgaattagggaaaaaagccgcctggagtgttagctcctgcaaaaccggcaacggcgtttct 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32834399 cggaggtaaccaagttttgattgtagatgaagacctccgtgaattagggaaaaaagccgcctggagtgttagctcctgcaaaaccggcaacggcgtttct 32834300  T
101 tctcttcgcgacgataatctcgaaacctattggcagttacttaacttttactctc 155  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32834299 tctcttcgcgacgataatctcgaaacctattggcagttacttaacttttactctc 32834245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University