View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3767_high_35 (Length: 202)
Name: NF3767_high_35
Description: NF3767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3767_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 5 - 188
Target Start/End: Complemental strand, 30371021 - 30370838
Alignment:
| Q |
5 |
agaaggaacgccgtgcggagaaacacaattaacgcgaatcaaatgaacacctaattcgcacgctgcacttctcattaatccatccatagctgattttgac |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30371021 |
agaaggaacgccgtgcggagaaacacaattaacgcgaatcaaatgaacacctaattcgcacgccgcacttctcattaatccatccatagctgattttgac |
30370922 |
T |
 |
| Q |
105 |
attgtatagccatgtgaagcaaatccacctatagttgcagctgcacttgaagtacaaataattgatcctccttttttacctttg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30370921 |
attgtatagccatgtgaagcaaatccacctatagttgcagctgcacttgaagtacaaataattgatcctccttttttacctttg |
30370838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University