View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3767_low_30 (Length: 241)
Name: NF3767_low_30
Description: NF3767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3767_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 32834399 - 32834245
Alignment:
| Q |
1 |
cggaggtaaccaagttttgattatagatgaagacctccgtgaattagggaaaaaagccgcctggagtgttagctcctgcaaaaccggcaacggcgtttct |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32834399 |
cggaggtaaccaagttttgattgtagatgaagacctccgtgaattagggaaaaaagccgcctggagtgttagctcctgcaaaaccggcaacggcgtttct |
32834300 |
T |
 |
| Q |
101 |
tctcttcgcgacgataatctcgaaacctattggcagttacttaacttttactctc |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32834299 |
tctcttcgcgacgataatctcgaaacctattggcagttacttaacttttactctc |
32834245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University