View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3767_low_31 (Length: 241)
Name: NF3767_low_31
Description: NF3767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3767_low_31 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 35 - 241
Target Start/End: Complemental strand, 34765901 - 34765697
Alignment:
| Q |
35 |
tgatgcactaacttttgaatgtcaaacgagttagctagcttatatagcatatatcaagtacaattccttatcaggttcgaaaattgaaggttctgtatgg |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
34765901 |
tgatgcactaacttttgaatgtcaaacgagttagctagcttatatagcatatatcaagtacaattccttatcaggtttgaaaattgaaggttctgcatgg |
34765802 |
T |
|
| Q |
135 |
tattttcttgtgggggaatttggtttcttgaactataccttcctaatctgaaaactgttcaagaaattggttaacaagttctattccagaagagatcttc |
234 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34765801 |
tattttcttgt--gggaatttggtttctggaactatacctttctaatctgaaaactgttcaagaaataggttaacaagttctattccagaagagatcttc |
34765704 |
T |
|
| Q |
235 |
tttagtt |
241 |
Q |
| |
|
||||||| |
|
|
| T |
34765703 |
tttagtt |
34765697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 86 - 173
Target Start/End: Complemental strand, 44016019 - 44015932
Alignment:
| Q |
86 |
tatcaagtacaattccttatcaggttcgaaaattgaaggttctgtatggtattttcttgtgggggaatttggtttcttgaactatacc |
173 |
Q |
| |
|
||||| ||||||||||||||||| || |||| ||||||||||| | || |||||||||||||||||||||||||| | |||||||| |
|
|
| T |
44016019 |
tatcaggtacaattccttatcagcttggaaagttgaaggttctacagagttttttcttgtgggggaatttggtttctggtactatacc |
44015932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University