View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3767_low_35 (Length: 227)
Name: NF3767_low_35
Description: NF3767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3767_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 16 - 143
Target Start/End: Complemental strand, 52580185 - 52580058
Alignment:
| Q |
16 |
aaagaaacgtcttcttgtttcatgtcaactaggcgacggttgatgctatgtatttgggccaacatttttctatttcacattttctttaagaccaaagcta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52580185 |
aaagaaacgtcttcttgtttcatgtcaactaggtgacggttgatgctatgtatttgggccaacatttttctatttcacattttctttaagaccaaagcta |
52580086 |
T |
 |
| Q |
116 |
tactaaatatttggctctagttccgtcg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
52580085 |
tactaaatatttggctctagttccgtcg |
52580058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University