View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3767_low_36 (Length: 225)
Name: NF3767_low_36
Description: NF3767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3767_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 81 - 211
Target Start/End: Original strand, 48635996 - 48636128
Alignment:
| Q |
81 |
tttattgaaccaatattcgctgtaggcccgtagcaaattcagattgagatagagggggagattcaaaagagaatcaaaatttcactttcccacca--nnn |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48635996 |
tttattgaaccaatattcgctgtaggcccgtagcaaattcagattgagatagagggggagattcaaaagagaatcaaaatttcactttcccaccattttt |
48636095 |
T |
 |
| Q |
179 |
nnnnngaaaaaggcgttattattatatcattat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
48636096 |
tttttgaaaaaggcgttattattatatcattat |
48636128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University