View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3768_high_14 (Length: 212)

Name: NF3768_high_14
Description: NF3768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3768_high_14
NF3768_high_14
[»] chr8 (1 HSPs)
chr8 (19-194)||(6974532-6974707)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 6974532 - 6974707
Alignment:
19 gggcacaattcaagtcactttttcttaattgggagacttagatataaaccatgtcaatataaatgtggtatatgacttggctttgggtccctttattgat 118  Q
    ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6974532 gggcacaattcaagtgactttttcttaattgggggacttagatataaaccatgtcaatataaatgtggtatatgacttggctttgggtccctttattgat 6974631  T
119 ttaaatggaatcttaatcctcaatcacgtatatgtcttgttaagtaacttgttttagggttatttatgcataaaaa 194  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
6974632 ttaaatggaatcttaatcctcaatcacgtatatgtctttttaagtaacttgttttagggttatttatgcataaaaa 6974707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University