View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3768_high_14 (Length: 212)
Name: NF3768_high_14
Description: NF3768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3768_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 6974532 - 6974707
Alignment:
| Q |
19 |
gggcacaattcaagtcactttttcttaattgggagacttagatataaaccatgtcaatataaatgtggtatatgacttggctttgggtccctttattgat |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6974532 |
gggcacaattcaagtgactttttcttaattgggggacttagatataaaccatgtcaatataaatgtggtatatgacttggctttgggtccctttattgat |
6974631 |
T |
 |
| Q |
119 |
ttaaatggaatcttaatcctcaatcacgtatatgtcttgttaagtaacttgttttagggttatttatgcataaaaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6974632 |
ttaaatggaatcttaatcctcaatcacgtatatgtctttttaagtaacttgttttagggttatttatgcataaaaa |
6974707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University