View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3768_low_13 (Length: 254)
Name: NF3768_low_13
Description: NF3768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3768_low_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 7277466 - 7277704
Alignment:
| Q |
19 |
acctcttggttgagccttagttttggttcgacttttcatgcatctggcgctgctttcaccgcaattttatagaa--gctcgaaaccaaacttctactaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7277466 |
acctcttggttgagccttagttttggttcgacttttcatgcgtctggcgctgctttcaccgcaattttatagagatgctcgaaaccaaacttctactaca |
7277565 |
T |
 |
| Q |
117 |
cttttcactgtgaatttggtgacacttgacagaagcaaactgtacttaact---------ctttacttacaaacaaactatctgttgaatatatgataaa |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
7277566 |
cttttcactgtgaatttggtgatacttgacagaagcaaactgtacttaactctttacttactttacttacaaacaaactatctgt--------tgataaa |
7277657 |
T |
 |
| Q |
208 |
cacattgtgtcatagaacatcttttcgaggtgagggtaaaactgctt |
254 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7277658 |
cacattgtgtcatagaacatcttttggaggtgagggtaaaactgctt |
7277704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University