View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3768_low_9 (Length: 289)

Name: NF3768_low_9
Description: NF3768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3768_low_9
NF3768_low_9
[»] chr7 (1 HSPs)
chr7 (49-270)||(5519772-5519993)


Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 49 - 270
Target Start/End: Original strand, 5519772 - 5519993
Alignment:
49 aatattatacactatggattattaggttggtgattattgatgggtggcctatgggatggttttcccttatgactatagtctttatacatgagacttccaa 148  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5519772 aatattatacactatggattattaggttggtggttattgatgggtggcctatgggatggttttcccttatgactatagtctttatacatgagacttccaa 5519871  T
149 tctcttttgcagcatcaatactttgagcttcttcagaaatttgtatagatcttgttgatctctctgggctacccttaattggcacaacatcacaattttg 248  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5519872 tctcttttgcagcatcaatactttgagcttcttcagaaatttgtatagatcttgttgatctctctgggctacccttaattggcacaacatcacaattttg 5519971  T
249 tgaacactttgtgtctgtgttg 270  Q
    |||||||||||||| |||||||    
5519972 tgaacactttgtgtttgtgttg 5519993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University