View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3768_low_9 (Length: 289)
Name: NF3768_low_9
Description: NF3768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3768_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 49 - 270
Target Start/End: Original strand, 5519772 - 5519993
Alignment:
| Q |
49 |
aatattatacactatggattattaggttggtgattattgatgggtggcctatgggatggttttcccttatgactatagtctttatacatgagacttccaa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5519772 |
aatattatacactatggattattaggttggtggttattgatgggtggcctatgggatggttttcccttatgactatagtctttatacatgagacttccaa |
5519871 |
T |
 |
| Q |
149 |
tctcttttgcagcatcaatactttgagcttcttcagaaatttgtatagatcttgttgatctctctgggctacccttaattggcacaacatcacaattttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5519872 |
tctcttttgcagcatcaatactttgagcttcttcagaaatttgtatagatcttgttgatctctctgggctacccttaattggcacaacatcacaattttg |
5519971 |
T |
 |
| Q |
249 |
tgaacactttgtgtctgtgttg |
270 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
5519972 |
tgaacactttgtgtttgtgttg |
5519993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University