View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3770_low_13 (Length: 284)
Name: NF3770_low_13
Description: NF3770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3770_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 272
Target Start/End: Original strand, 18283598 - 18283856
Alignment:
| Q |
17 |
agtaatggttaagctagctcaaatagttggatgttttgtaatttaagaattaatattttggttatatatgaatt---tgtaggatggggagggtaaagct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18283598 |
agtaatggttaagctagctcaaatagttggatgttttctaatttaagaattaatattttggttatatatgaattatttgtaggatggggagggtaaagct |
18283697 |
T |
 |
| Q |
114 |
aaagataaagaggttggagaacacaaatggacgccaagcaacctatgccaaaagaaagaatggaataatgaagaaagctagtgaattatctatattatgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18283698 |
aaagataaagaggttggagaacacaaatggacgccaagcaacctatgccaaaagaaagaatggaataatgaagaaagctagtgaattatctatattatgt |
18283797 |
T |
 |
| Q |
214 |
gatatagatattatacttcttatgttttctccaggtggaaaaccttcattatgcacagg |
272 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18283798 |
gatatagatattatacttctaatgttttctccaggtggaaaaccttcattatgcacagg |
18283856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University