View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_high_111 (Length: 284)
Name: NF3772_high_111
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_high_111 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 13191545 - 13191316
Alignment:
| Q |
17 |
cctatacttttacaacttgatccaatcccttggtgcaaacctcaccgcagtttcagattcaataactcttggctgcttcaacccaaactcactcatcttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13191545 |
cctatacttttacaacttgatccaatcccttggtgcaaacctcaccgc-------gattcaataactcttggctgcttcaacccaaactcactcatcttg |
13191453 |
T |
 |
| Q |
117 |
ttagaagtaacatggggtcactacccttcttccaatgttattactaaacttaattattgtgcagaagacatttcctcctggagccgagatgctttcccga |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13191452 |
ttagaagcaacatggggtcactacccttcttccaatcttattactaaacttaattattgtgcagaagacatttcctcctggagccgagacgctttcccga |
13191353 |
T |
 |
| Q |
217 |
attatcgaaagctcaacaataagcagcgtacccaaat |
253 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13191352 |
attatcgaaagctcatcaataagcagcgtacccaaat |
13191316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University