View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_high_140 (Length: 252)
Name: NF3772_high_140
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_high_140 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 110 - 252
Target Start/End: Complemental strand, 51935765 - 51935623
Alignment:
| Q |
110 |
ctcatgtcttacacaatcaaacaaaaggagagaaaacaatgagtatcaatgactagtttccctgtttctgaccttgtagttgatctgaattcaggtttat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51935765 |
ctcatgtcttacacaatcaaacaaaaggagagaaaacaatgagtatcaatgactagtttccctgtttctgaccttgtagttgatctgaattcaggtttat |
51935666 |
T |
|
| Q |
210 |
gtgaatgatcaatttctgaattgggatccagaacacagaatca |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51935665 |
gtgaatgatcaatttctgaattgggatccagaacacagaatca |
51935623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 51935893 - 51935858
Alignment:
| Q |
11 |
cagagaaggaatgagttgcactttgagagtccaatg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51935893 |
cagagaaggaatgagttgcactttgagagtccaatg |
51935858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 199 - 252
Target Start/End: Complemental strand, 28138403 - 28138350
Alignment:
| Q |
199 |
ttcaggtttatgtgaatgatcaatttctgaattgggatccagaacacagaatca |
252 |
Q |
| |
|
||||||||| ||||||||||||||| |||| ||||||||||| ||||||||| |
|
|
| T |
28138403 |
ttcaggtttttgtgaatgatcaattcttgaactgggatccagagaacagaatca |
28138350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University