View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_high_159 (Length: 245)
Name: NF3772_high_159
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_high_159 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 130 - 245
Target Start/End: Original strand, 31140094 - 31140209
Alignment:
| Q |
130 |
ttaaagattggaatgaagtttctaccccaaaacataaacaaagtgaaatggttctttaactttctcaacatgtactcaagaataaataaaagggtataag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31140094 |
ttaaagattggaatgaagtttctaccccaaaacataaacaaagtgaaatggttctttaactttctcaacatgtactcaagaataaataaaagggtataag |
31140193 |
T |
 |
| Q |
230 |
tacaacaaggaattac |
245 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31140194 |
tacaacaaggaattac |
31140209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University