View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_high_165 (Length: 242)
Name: NF3772_high_165
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_high_165 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 42116926 - 42116719
Alignment:
| Q |
19 |
ctcactacaattaatcagtggtcatacagggattccgctgtagcctacacatgggtgaggtgactaattcccatagaatgcagttgactcaatactcgac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
42116926 |
ctcactacaattaatcagtggtcatacagggattccgctgtagcctacacatgggtgaggtgactaatccccatagaatgcagttgactcaatacttgac |
42116827 |
T |
|
| Q |
119 |
tctcatgtaggtaattatttgtttgtaatatttgagatctctaacatttaatataggtgtttgtaatttaatgttgtttgnnnnnnnaggcttgggacat |
218 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42116826 |
tctcatgtagataattatttgtttgtaatatttgagatctctaacatttaatatatgtgtttgtaatttaatgttgtttgtttttttaggcttgggacat |
42116727 |
T |
|
| Q |
219 |
ggagaatt |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
42116726 |
ggagaatt |
42116719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University