View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_high_183 (Length: 238)
Name: NF3772_high_183
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_high_183 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 71 - 238
Target Start/End: Original strand, 32467628 - 32467795
Alignment:
| Q |
71 |
aaagagatacaaacttttggtgtaannnnnnnctttctaaatttaccgtttataaacattaatttatatgttcgctaattttctttaatgttgaatatat |
170 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32467628 |
aaagaaatacaaacttttggtgtaatttttttctttctaaatttaccggttataaacattaatttatatgttcggtaattttctttaatgttgaatatat |
32467727 |
T |
 |
| Q |
171 |
tattttcgattgttcaagagacaacttaggtctcgcaaatggagaaagcttagttaggagttgagaat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32467728 |
tattttcgattgttcaagagacaacttaggtctcgcaaatggagaaagcttagttaggagttgagaat |
32467795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University