View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3772_high_188 (Length: 236)

Name: NF3772_high_188
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3772_high_188
NF3772_high_188
[»] chr4 (1 HSPs)
chr4 (1-221)||(54817321-54817541)


Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 54817541 - 54817321
Alignment:
1 ttttgcaccttgatcatgattatcattatgctcttattggacaacctagcaggaattatctttgggtatgtgttttactttttcaattctcttgactttc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||| ||||    
54817541 ttttgcaccttgatcatgattatcattatgctcttattggacaacctagcaggaattatctttgggtatgtgttttactttttcaattcaattgagtttc 54817442  T
101 tgaatgtatgtgttttgaaaccatttatgttattataattcagaatctctaattatgttaattggattaggttatttaggttgatttctcacttggttag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
54817441 tgaatgtatgtgttttgaaaccatttatgttattataattcagaatctctaattatgttaattggattaggttatttaggttgatttttcacttggttag 54817342  T
201 taaactattatatgataattt 221  Q
    |||||||||||||||||||||    
54817341 taaactattatatgataattt 54817321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University