View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_high_190 (Length: 236)
Name: NF3772_high_190
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_high_190 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 9 - 176
Target Start/End: Original strand, 35098446 - 35098613
Alignment:
| Q |
9 |
agaagcaaaggatgagagagagggtggaggtatcggatggtgacaggtggagtggagttttgggagataggaagctaaagtctgagatgagagaagctag |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35098446 |
agaaggaaaggatgagagagagggtggaggtatcggatggtgacaggtggagtggagttttgggagataggaagctaaagtctgagatgagagaagctag |
35098545 |
T |
 |
| Q |
109 |
aaataggtgtcagaattttagtatactactatatcttagtgttgatatttttagttagtgtaatttat |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35098546 |
aaataggtgtcagaattttagtatactactatatcttagtgttgatatttttggttagtgtaatttat |
35098613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University