View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3772_high_206 (Length: 227)

Name: NF3772_high_206
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3772_high_206
NF3772_high_206
[»] chr3 (3 HSPs)
chr3 (7-80)||(25990007-25990080)
chr3 (156-227)||(25989848-25989919)
chr3 (157-227)||(25993948-25994018)


Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 7 - 80
Target Start/End: Complemental strand, 25990080 - 25990007
Alignment:
7 gtcaatgctcacgtggatgtcgtggcacgcgctgattgtattaatattgttgacaatatattctttgatcattg 80  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||    
25990080 gtcaatgctcacgtggatgtcgtggcacacgctgattgtattaatattgttgacaatatattctttaatcattg 25990007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 156 - 227
Target Start/End: Complemental strand, 25989919 - 25989848
Alignment:
156 gtgcttttattgagttgcatgtaggaggttagatatgattgtcttcaggggattgcggatgaaatattgtca 227  Q
    |||||||||||||||||||| ||| |||||| ||||||||||||||||||||||||||| ||| ||||||||    
25989919 gtgcttttattgagttgcatatagaaggttaaatatgattgtcttcaggggattgcggaagaattattgtca 25989848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 157 - 227
Target Start/End: Complemental strand, 25994018 - 25993948
Alignment:
157 tgcttttattgagttgcatgtaggaggttagatatgattgtcttcaggggattgcggatgaaatattgtca 227  Q
    ||||||||||||| ||| |  || |||||| ||||||||||||||   |||||||||||||||||||||||    
25994018 tgcttttattgagatgcttagagaaggttaaatatgattgtcttcgcaggattgcggatgaaatattgtca 25993948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University