View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_high_75 (Length: 337)
Name: NF3772_high_75
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_high_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 48 - 322
Target Start/End: Complemental strand, 47314527 - 47314245
Alignment:
| Q |
48 |
tgaagtgggtttgtgtggtccaaagcaaaaagggtatgaaaatgggaaattgttcttaatggaacatgaacatgccataagatgaagaagaa---acggt |
144 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47314527 |
tgaagtgggtttctgtggtccaaagcaaaaagggtatgaaaatgggaaattgttcttaatggaacatgaacatgccataagatgaagaagaagaaacggt |
47314428 |
T |
|
| Q |
145 |
tttgttttttgttctgtagcgcgttgaattgaacagctttaagcgtttcaaattcaattatttgttttgttt-----ggtttttctcacaaaacactatc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47314427 |
tttgttttttgttctgtagcgcgttgaattgaacagctttaagcgtttcaaattcaattatttgttttgttttgtttggtttttctcacaaaacactatc |
47314328 |
T |
|
| Q |
240 |
actctcactatgtttctgcgttttgttttgatgatgcaaaagtaaagtagagagtgaaaaagaggaattaagaatgagatttg |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47314327 |
actctcactatgtttctgcgttttgttttgatgatgcaaaagtaaagtagagagtgaaaaagaggaattaagaatgagatttg |
47314245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 7 - 50
Target Start/End: Complemental strand, 47314583 - 47314540
Alignment:
| Q |
7 |
gaagcaaaggaagaagagaagaaagaaacggagaatcatgatga |
50 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47314583 |
gaagaaaaggaagaagagaagaaagaaacggcgaatcatgatga |
47314540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University