View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_107 (Length: 296)
Name: NF3772_low_107
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_107 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 278
Target Start/End: Original strand, 41361454 - 41361722
Alignment:
| Q |
10 |
aaaagaatcaaatccctatgtggaccgtaacaaacnnnnnnnatgagtttgtctaattaatcaaagatacaattccacttttatccacctatttttcctt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41361454 |
aaaagaatcaaatccctatgtggaccgtaacaaactttttttatgagtttgtctaattaatcaaagatacaattccacttttatccacctatttttcctt |
41361553 |
T |
 |
| Q |
110 |
tcttgcaaaaatagtctccctatttctaaatcgaacattgtgcaccctctcccnnnnnnnacttttgttgcaatttcaacccaaacccttatttatagtc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41361554 |
tcttgcaaaaatagtctccctatttctaaatcgaacattgtgcaccctctccctttttttacttttgttgcaatttcaacccaaacccttatttatagtc |
41361653 |
T |
 |
| Q |
210 |
atcaaagtgctttttagttttgagtttaaattggaattgcataacataattctttgagatacaatttac |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41361654 |
atcaaagtgctttttagttttgagtttaaattggaattgcataacataattctttgagatacaatttac |
41361722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University