View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_121 (Length: 276)
Name: NF3772_low_121
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_121 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 24 - 259
Target Start/End: Original strand, 8584856 - 8585091
Alignment:
| Q |
24 |
tttgggttttgatttccacattggttccgttcgcgatgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttcaactctcttgc |
123 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8584856 |
tttgtgttttgatttccacattggttccgttcgcaatgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttccactctcttgc |
8584955 |
T |
 |
| Q |
124 |
ctttgtttcttccaattctttctttgtttgctcaagttctttcttgagggatttgatgcattgtgctaagaagttagcttcttcttttgatccttcaagt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8584956 |
ctttgtttcttccaattctttctttgtttgctcaagttctttcttgagggatttgatgcattgtgctaagaagttagcttcttcttttgatccttcaagt |
8585055 |
T |
 |
| Q |
224 |
ttttgctttgtttcttctagctcagctgctaatgct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8585056 |
ttttgctttgtttcttctagctcagctgctaatgct |
8585091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University