View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_123 (Length: 273)
Name: NF3772_low_123
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_123 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 2987138 - 2986893
Alignment:
| Q |
18 |
gtaactatacaaacattaactagaaaatattaaagccacgagttttgcttacctcacttggcagatttctatgcaaaactgaaagatctataaatgacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2987138 |
gtaactatacaaacattaactagaaaatattaaagccacgagttttgcttacctcacttggcagatttctatgcaaaactgaaagatctataaatgacat |
2987039 |
T |
|
| Q |
118 |
gtaccaaactcatagcttttgtccacnnnnnnnngttccaaagttagctagctgaactgagtcactgacttagcagtaaaatagacagacatagatttac |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2987038 |
gtaccaaactcatagcttttgtccacaaaaaaaagttccaaagttagctagctgaactgagtcactgacttagcagtaaaatagacagacatagatttac |
2986939 |
T |
|
| Q |
218 |
tggccaaattgccatgaattacatgttccaaacatttcttcttcat |
263 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2986938 |
tggccacattgccatgaattacatgttccaaacatttcttcttcat |
2986893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University