View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_137 (Length: 259)
Name: NF3772_low_137
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_137 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 28730303 - 28730070
Alignment:
| Q |
17 |
agtttacactgttgttcatctaatgtagctaattcacaccgttgcttagttctttttagtttgtgctgcacttctttgtctcatgaattgtaactctgaa |
116 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
28730303 |
agtttacaccgttgttcatctaatgtagctaattcacaccgttgcttagttctttttagtttgtgctgcacttctttgtctcatgaagtgaaactctgaa |
28730204 |
T |
|
| Q |
117 |
tttgtagttagttcacactattatccatatatactctatgttgcttaactagttcgttaataaaacaatttgtggatttagtctttacagattttcttga |
216 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28730203 |
tttgtagttaattcacactattatccatatatactctatgttgcttaactagttcgttaataa-------tgtggatttagtctttacagattttctt-- |
28730113 |
T |
|
| Q |
217 |
gagattatcttgtgtatgatgtatcaattcatggtttcttaca |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730112 |
gagattatcttgtgtatgatgtatcaattcatggtttcttaca |
28730070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 38120726 - 38120529
Alignment:
| Q |
17 |
agtttacactgttgttcatctaatgtagctaattcacaccgttgcttagttctttttagtttgtgctgcacttctttgtctcatgaattgtaactctgaa |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| || |||| |||| |
|
|
| T |
38120726 |
agtttacactgttgtccatctaatgtagctaattcacacggttccttagttctttttagtttgtgctgcacttctttgtctcatgaagtgaaactttgaa |
38120627 |
T |
|
| Q |
117 |
tttgtagttagttcacactattatccatatatactctatgttgcttaactagttcgttaataaaacaatttgtggatttagtctttacagattttcttga |
216 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||| ||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120626 |
tttgtagttaattcacactattatcc--aactacactatgttgcttaaatagttcttcaataaaacaatttgtggatttagtctttacagattttcttga |
38120529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 3928143 - 3928106
Alignment:
| Q |
57 |
gttgcttagttctttttagtttgtgctgcacttctttg |
94 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
3928143 |
gttgcttagatctttttagtttgtgcagcacttctttg |
3928106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University