View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_152 (Length: 250)
Name: NF3772_low_152
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_152 |
 |  |
|
| [»] scaffold0740 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0740 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: scaffold0740
Description:
Target: scaffold0740; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 25 - 234
Target Start/End: Complemental strand, 1837 - 1628
Alignment:
| Q |
25 |
caaccggtttcacccctccaaatagttcaactgatttcggtaaatggtgcaactggttgtcatgtctcaaaactgttaaaaatgagcccgactttgtgta |
124 |
Q |
| |
|
|||||||| || ||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1837 |
caaccggtatcgcccctccaaatagttcaactggtttcggtaaatggtgcaaccggttgtcatgtctcaaaactgttaaaaatgagcccgactttgtgta |
1738 |
T |
 |
| Q |
125 |
attggctccacgaactatgtaatgataatgcaaacataatagcaatacaataacatcagagagagtaaatatatgttatgatgattaatataatgggaat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1737 |
attggctccacgaactatgtaatgataatgcaaacataatagcaatacaataacatcagagagagtaaatatatgtaatgatgattaatataatgggaat |
1638 |
T |
 |
| Q |
225 |
gattactaac |
234 |
Q |
| |
|
|||||||||| |
|
|
| T |
1637 |
gattactaac |
1628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0740; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 1883 - 1851
Alignment:
| Q |
1 |
tgggatttgttttataaacccgtgcaaccggtt |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1883 |
tgggatttgttttataaacccgtgcaaccggtt |
1851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University