View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3772_low_162 (Length: 245)

Name: NF3772_low_162
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3772_low_162
NF3772_low_162
[»] chr3 (2 HSPs)
chr3 (116-237)||(2305716-2305837)
chr3 (1-40)||(2305914-2305953)


Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 116 - 237
Target Start/End: Complemental strand, 2305837 - 2305716
Alignment:
116 gcattagtgtatgccaataaaagttaactcatttggtaaggtatcgattcacccgcaaggttgtaggttcaactcttgttatcaatgtgacgacttcttt 215  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||     
2305837 gcattagtgtatgccaataaaaattaactcatttggtaaggtatcgattcacccgcaaggttgtaggttcaactcttgttatcaatgtgacgacctcttc 2305738  T
216 gatggataatttatacatacct 237  Q
    ||||||| ||||||||||||||    
2305737 gatggatgatttatacatacct 2305716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 2305953 - 2305914
Alignment:
1 tttagttatttgacatataatttaacataagtttaaagtg 40  Q
    |||||||||||||||||||| |||||||||||||||||||    
2305953 tttagttatttgacatataagttaacataagtttaaagtg 2305914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University