View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_162 (Length: 245)
Name: NF3772_low_162
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_162 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 116 - 237
Target Start/End: Complemental strand, 2305837 - 2305716
Alignment:
| Q |
116 |
gcattagtgtatgccaataaaagttaactcatttggtaaggtatcgattcacccgcaaggttgtaggttcaactcttgttatcaatgtgacgacttcttt |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2305837 |
gcattagtgtatgccaataaaaattaactcatttggtaaggtatcgattcacccgcaaggttgtaggttcaactcttgttatcaatgtgacgacctcttc |
2305738 |
T |
|
| Q |
216 |
gatggataatttatacatacct |
237 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
2305737 |
gatggatgatttatacatacct |
2305716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 2305953 - 2305914
Alignment:
| Q |
1 |
tttagttatttgacatataatttaacataagtttaaagtg |
40 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2305953 |
tttagttatttgacatataagttaacataagtttaaagtg |
2305914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University